Prevalence of Dirofilaria immitis in dogs in Antalya province

This study was conducted to determine the prevalence of Dirofilaria immitis in dogs in the Antalya province. For this purpose, blood samples were collected from a total of 205 dogs, including 109 males and 96 females, from the districts of Kepez, Konyaaltı, Muratpaşa, and Gazipaşa. The dogs were of different breeds and ages, and included both owned/stray dogs with and without clinical symptoms. The blood samples were brought to the Department of Parasitology, Faculty of Veterinary Medicine, Burdur Mehmet Akif Ersoy University, where they were examined for the presence of microfilariae using the Native Examination and Modified Knott methods. Subsequently, all blood samples were molecularly evaluated for Dirofilaria immitis using the Polymerase Chain Reaction (PCR) method. As a result of the study, no microfilariae were detected using the Native Examination and Modified Knott methods. Additionally, no positive results were obtained in the PCR method, which was performed using the DICOI-F1 (F; AGTGTAGAGGGTCAGCCTGAGTTA) and DICOI-R1 (R; ACAGGCACTGACAATACCAAT) primers that amplify the conserved region of the specific COI* gene region with a size of 203 bp. This thesis represents the first molecular study to reveal the distribution of Dirofilaria immitis in the Antalya region. The findings contribute to the parasitic fauna and indicate the necessity for planning new studies by expanding the study area and increasing the number of animals examined. Additionally, the vector potential of mosquitoes should be further investigated. In conclusion, considering the effects of Dirofilaria immitis on its definitive hosts and its zoonotic characteristics, it is recommended that these studies be conducted periodically to better understand the epidemiology of the parasite and to develop effective control and prevention programs.