Investigation of antibiotic resistance profiles and methicillin resistance genes of methicillin-resistant Staphylococcus aureus strains isolated from clinical samples in Siirt training and research hospital

Introduction and Aim: Methicillin-resistant Staphylococcus aureus (MRSA) strains are considered to be one of the most common bacteria responsible for various infections in humans and animals. In this study, it was aimed to determine the molecular profile of methicillin-resistant S. aureus strains isolated from clinical samples of Siirt Training and Research Hospital. Materials and methods: In this study, 20 coagulase positive S. aureus strains were cultured from patients admitted to Siirt Training and Research Hospital between July 2020 and July 2021. Different clinical samples were used for antibiotic susceptibility testing and identification procedures. Bacterial cultures were made and evaluated. MRSA has been identified across cultures from clinical specimens and using universal primer pairs with the following nucleotide sequences mecA-F: 5′'-CCTAGTAAAAGCTCCGGAA-3''-mecA-R5''-CTAGTC-CATTCGGTCCA-3′' and mecC-F: 5 ′' TGTTGTAGCAATGTTCACAC 3′'-mecC-R: 5′' CAAGCACTTAATATCAACGC 3′' for amplification mecA and mecC genes. Isolated S. aureus strains were identified by 16S rRNA gene analysis using universal primers 68f-TNANACATGCAAGTCGRRCG-518r WTTACCCGGC GTGCTGG by PCR amplification. Results: In this study, 20 coagulase positive S. aureus strains were isolated and identified from patients admitted to Siirt Training and Research Hospital. The 16S rRNA gene sequences showed that the isolated strains had high similarity (99-100%) to the 16S rRNA genes of S. aureus strains available in the NCBI GenBank. While the mecA gene was detected in 18 of 20 strains, the mecC gene was not detected in any of the strains. A high percentage of MRSA was found to be penicillin resistant (75%). Conclusion: The findings of this study confirmed the importance of mecA, mecC, and 16S rRNA genes in MRSA detection and emphasized the value of molecular techniques as an epidemiological tool, as well as the increasing frequency of MRSA in Turkey. Keywords: Gene sequencing; methicillin resistance, Staphylococcus aureus; 16S rRNA; the mecA gene; mecC gene