Identification of complex vertebral malformation inharited disease in holstein cows reared in Antalya by using allele-spesific PCR (AS-PCR)

The aim of this study was to investigate the presence of complex vertebral malfor-mation (CVM) in Holstein cows reared in Antalya by using allele-spesific PCR (AS-PCR). For this purpose, 200 Holstein cows reared by member breeders of Antalya Cattle Breeders Association and reared in Akdeniz University Faculty of Agriculture Department of Animal Science, also member of the same association, were used to de-tect presence of CVM disease. DNAs taken from cattle were isolated and F 5' CACA-ATTT GTAGGTCTCATGGCAG -3' (Normal allele), F 5' CACAATTTGTAGGTCT-CATGG CAT -3' (CVM-mutant allele), R 5' GTTATACTACAGGAGTCACCTCT -3' (reverse primer for both primers) primers were used to amplify 3954 bp region located on 3. chromosome of SLC35A3. CVM-carrier individuals were detected according to presence or absence of PCR products.