Connexin26 35 delG mutation and sensorineural hearing loss

Hearing impairment is one of the most common sensory impairment and incidence of hearin loss is 1/1000. Prevelance of hearing loss increases due to age and it is the most common sensorial disorder among the elderly. The most important role causing non-syndromic hearing loss is Coonnexin 26(GJB2/Cx26) gene which is encoded autosomal recessive (DFNB1). The most frequent mutation inthe Caucasians. In its most typical presentation of age related hearing impairment (ARHI) alias presbycusis, symetrical, sensorineural and more pronounced in the high frequencies. The prevelance of hearing loss is 37% for people aged 61 to 70, and it is 60% for people aged 71 to 80 years. Enviromentel and genetic factors contribute to the etiology of the ARHI. We study the relation between sensorineural hearing impairment especially ARHI and Connexin 26 35delG mutation.In this study, 34 patients with ARHI, 35 patients under 45 years old with bilateral sensorineural hearing loss, 17 patients with unilateral hearing loss and 34 healthy volunteers .analyzed for Cx26 35delG mutation. The blood samples analysed with HighPure PCR Template Preparation Kit (Cat. No: 11796828001, Roche Diagnostic, Germany), DNA isolation was performed. Realtime polmerase chain reaction(PCR) primers; PCR-primer forward: AGTCTCCCTGTTCTGTCCTAGCT and PCR-primer reversed: CTTTCCAATGCTGGTGGAGTG ve Florasan Labeled probe: TTCACACCCCCCAG, Anchor Probe: TCGTCTGCAGCGTGCCCCAAATCCATCTTCT analyzed by TIB MOLBIOL GmbH (Eresburgstraße 22-23 D-12103 Berlin) company.SPSS(Statistical Package for Social Sciences) for windows 17.0 program was used for the statistical analyses. The datas were summarized with a table. To compare the distribution of Connexin 26 35delG mutation Chi- Square test was used.In the ARHI study group we could identify Cx26 35delG mutation in only 1(2,9%) case. In control group there is no mutant gene. When we analysed this data statistically, we could not identify any relation between patient and control groups.